remap

 

Function

Display a sequence with restriction cut sites, translation etc

Description

The Restriction Enzyme database (REBASE) is a collection of information about restriction enzymes and related proteins. It contains published and unpublished references, recognition and cleavage sites, isoschizomers, commercial availability, methylation sensitivity, crystal and sequence data. DNA methyltransferases, homing endonucleases, nicking enzymes, specificity subunits and control proteins are also included. Most recently, putative DNA methyltransferases and restriction enzymes, as predicted from analysis of genomic sequences, are also listed.

The home page of REBASE is: http://rebase.neb.com/

This program uses REBASE data to find the recognition sites and/or cut sites of restriction enzymes in a nucleic acid sequence.

This program displays the cut sites on both strands by default. It will optionally also display the translation of the sequence.

There are many options to change the style of display to aid in making clear presentations.

One potentially very useful option is '-flatreformat' that displays not only the cut sites which many other restriction cut-site programs will show, but also shows the recognition site.

By default, only one of any group of isoschizomers (enzymes that have the same recognition site and cut positions) is reported (this behaviour can be turned off by setting the qualifier '-limit' to be false.) The reported enzyme from any one group of isoschizomers (the prototype) is specified in the REBASE database and the information is held in the data file 'embossre.equ'. You may edit this file to set your own preferred prototype,if you wish.

Usage

Here is a sample session with remap

This example uses only a small region of the input sequence to save space. This is run with a small test version of the restriction enzyme database and so you will probably see more enzymes when you run this.


% remap -notran -sbeg 1 -send 60 
Display a sequence with restriction cut sites, translation etc..
Input sequence(s): tembl:eclac
Comma separated enzyme list [all]: taqi,bsu6i,acii,bsski
Minimum recognition site length [4]: 
Output file [eclac.remap]: 

Go to the input files for this example
Go to the output files for this example

Example 2

This is an example where all enzymes in the REBASE database are used, (but only the prototypes of the isoschizomers are reported by default). This is run with a small test version of the restriction enzyme database and so you will probably see more enzymes when you run this.


% remap -notran -sbeg 1 -send 60 
Display a sequence with restriction cut sites, translation etc..
Input sequence(s): tembl:eclac
Comma separated enzyme list [all]: 
Minimum recognition site length [4]: 
Output file [eclac.remap]: 

Go to the output files for this example

Example 3

This is an example where all enzymes in the REBASE database are used but the -limit qualifier is not set so that all of the enzymes are displayed and not just only the prototypes of the isoschizomers. This is run with a small test version of the restriction enzyme database and so you will probably see more enzymes when you run this.


% remap -notran -sbeg 1 -send 60 -nolimit 
Display a sequence with restriction cut sites, translation etc..
Input sequence(s): tembl:eclac
Comma separated enzyme list [all]: 
Minimum recognition site length [4]: 
Output file [eclac.remap]: 

Go to the output files for this example

Example 4

This shows the 'flat' format: This is run with a small test version of the restriction enzyme database and so you will probably see more enzymes when you run this.


% remap -notran -sbeg 1 -send 60 -flat 
Display a sequence with restriction cut sites, translation etc..
Input sequence(s): tembl:eclac
Comma separated enzyme list [all]: 
Minimum recognition site length [4]: 
Output file [eclac.remap]: 

Go to the output files for this example

Command line arguments

   Mandatory qualifiers:
  [-sequence]          seqall     Sequence database USA
   -enzymes            string     The name 'all' reads in all enzyme names
                                  from the REBASE database. You can specify
                                  enzymes by giving their names with commas
                                  between then, such as:
                                  'HincII,hinfI,ppiI,hindiii'.
                                  The case of the names is not important. You
                                  can specify a file of enzyme names to read
                                  in by giving the name of the file holding
                                  the enzyme names with a '@' character in
                                  front of it, for example, '@enz.list'.
                                  Blank lines and lines starting with a hash
                                  character or '!' are ignored and all other
                                  lines are concatenated together with a comma
                                  character ',' and then treated as the list
                                  of enzymes to search for.
                                  An example of a file of enzyme names is:
                                  ! my enzymes
                                  HincII, ppiII
                                  ! other enzymes
                                  hindiii
                                  HinfI
                                  PpiI
   -sitelen            integer    This sets the minimum length of the
                                  restriction enzyme recognition site. Any
                                  enzymes with sites shorter than this will be
                                  ignored.
  [-outfile]           outfile    If you enter the name of a file here then
                                  this program will write the sequence details
                                  into that file.

   Optional qualifiers:
   -mincuts            integer    This sets the minimum number of cuts for any
                                  restriction enzyme that will be considered.
                                  Any enzymes that cut fewer times than this
                                  will be ignored.
   -maxcuts            integer    This sets the maximum number of cuts for any
                                  restriction enzyme that will be considered.
                                  Any enzymes that cut more times than this
                                  will be ignored.
   -single             boolean    If this is set then this forces the values
                                  of the mincuts and maxcuts qualifiers to
                                  both be 1. Any other value you may have set
                                  them to will be ignored.
   -[no]blunt          boolean    This allows those enzymes which cut at the
                                  same position on the forward and reverse
                                  strands to be considered.
   -[no]sticky         boolean    This allows those enzymes which cut at
                                  different positions on the forward and
                                  reverse strands, leaving an overhang, to be
                                  considered.
   -[no]ambiguity      boolean    This allows those enzymes which have one or
                                  more 'N' ambiguity codes in their pattern to
                                  be considered
   -plasmid            boolean    If this is set then this allows searches for
                                  restriction enzyme recognition site and cut
                                  postions that span the end of the sequence
                                  to be considered.
   -[no]commercial     boolean    If this is set, then only those enzymes with
                                  a commercial supplier will be searched for.
                                  This qualifier is ignored if you have
                                  specified an explicit list of enzymes to
                                  search for, rather than searching through
                                  'all' the enzymes in the REBASE database. It
                                  is assumed that, if you are asking for an
                                  explicit enzyme, then you probably know
                                  where to get it from and so all enzymes
                                  names that you have asked to be searched
                                  for, and which cut, will be reported whether
                                  or not they have a commercial supplier.
   -table              menu       Genetic code to use
   -[no]cutlist        boolean    This produces lists in the output of the
                                  enzymes that cut, those that cut but are
                                  excluded because that cut fewer times than
                                  mincut or more times than maxcut and those
                                  enzymes that do not cut.
   -flatreformat       boolean    This changes the output format to one where
                                  the recognition site is indicated by a row
                                  of '===' characters and the cut site is
                                  pointed to by a '>' character in the forward
                                  sense, or a '<' in the reverse sense
                                  strand.
   -[no]limit          boolean    This limits the reporting of enzymes to just
                                  one enzyme from each group of
                                  isoschizomers. The enzyme chosen to
                                  represent an isoschizomer group is the
                                  prototype indicated in the data file
                                  'embossre.equ', which is created by the
                                  program 'rebaseextract'. If you prefer
                                  different prototypes to be used, make a copy
                                  of embossre.equ in your home directory and
                                  edit it. If this value is set to be false
                                  then all of the input enzymes will be
                                  reported. You might like to set this to
                                  false if you are supplying an explicit set
                                  of enzymes rather than searching 'all' of
                                  them.

   Advanced qualifiers:
   -[no]translation    boolean    This displays the 6-frame translations of
                                  the sequence in the output.
   -[no]reverse        boolean    This displays the cut sites and translation
                                  of the reverse sense.
   -orfminsize         integer    This sets the minimum size of Open Reading
                                  Frames (ORFs) to display in the
                                  translations. All other translation regions
                                  are masked by changing the amino acids to
                                  '-' characters.
   -uppercase          range      Regions to put in uppercase.
                                  If this is left blank, then the sequence
                                  case is left alone.
                                  A set of regions is specified by a set of
                                  pairs of positions.
                                  The positions are integers.
                                  They are separated by any non-digit,
                                  non-alpha character.
                                  Examples of region specifications are:
                                  24-45, 56-78
                                  1:45, 67=99;765..888
                                  1,5,8,10,23,45,57,99
   -highlight          range      Regions to colour if formatting for HTML.
                                  If this is left blank, then the sequence is
                                  left alone.
                                  A set of regions is specified by a set of
                                  pairs of positions.
                                  The positions are integers.
                                  They are followed by any valid HTML font
                                  colour.
                                  Examples of region specifications are:
                                  24-45 blue 56-78 orange
                                  1-100 green 120-156 red
                                  A file of ranges to colour (one range per
                                  line) can be specifed as '@filename'.
   -threeletter        boolean    Display protein sequences in three-letter
                                  code
   -number             boolean    Number the sequences
   -width              integer    Width of sequence to display
   -length             integer    Line length of page (0 for indefinite)
   -margin             integer    Margin around sequence for numbering
   -[no]name           boolean    Set this to be false if you do not wish to
                                  display the ID name of the sequence
   -[no]description    boolean    Set this to be false if you do not wish to
                                  display the description of the sequence
   -offset             integer    Offset to start numbering the sequence from
   -html               boolean    Use HTML formatting

   Associated qualifiers:
  "-sequence" related qualifiers
   -sbegin1             integer    First base used
   -send1               integer    Last base used, def=seq length
   -sreverse1           boolean    Reverse (if DNA)
   -sask1               boolean    Ask for begin/end/reverse
   -snucleotide1        boolean    Sequence is nucleotide
   -sprotein1           boolean    Sequence is protein
   -slower1             boolean    Make lower case
   -supper1             boolean    Make upper case
   -sformat1            string     Input sequence format
   -sopenfile1          string     Input filename
   -sdbname1            string     Database name
   -sid1                string     Entryname
   -ufo1                string     UFO features
   -fformat1            string     Features format
   -fopenfile1          string     Features file name
  "-outfile" related qualifiers
   -odirectory2         string     Output directory

   General qualifiers:
   -auto                boolean    Turn off prompts
   -stdout              boolean    Write standard output
   -filter              boolean    Read standard input, write standard output
   -options             boolean    Prompt for required and optional values
   -debug               boolean    Write debug output to program.dbg
   -acdlog              boolean    Write ACD processing log to program.acdlog
   -acdpretty           boolean    Rewrite ACD file as program.acdpretty
   -acdtable            boolean    Write HTML table of options
   -verbose             boolean    Report some/full command line options
   -help                boolean    Report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning             boolean    Report warnings
   -error               boolean    Report errors
   -fatal               boolean    Report fatal errors
   -die                 boolean    Report deaths


Mandatory qualifiers Allowed values Default
[-sequence]
(Parameter 1)
Sequence database USA Readable sequence(s) Required
-enzymes The name 'all' reads in all enzyme names from the REBASE database. You can specify enzymes by giving their names with commas between then, such as: 'HincII,hinfI,ppiI,hindiii'. The case of the names is not important. You can specify a file of enzyme names to read in by giving the name of the file holding the enzyme names with a '@' character in front of it, for example, '@enz.list'. Blank lines and lines starting with a hash character or '!' are ignored and all other lines are concatenated together with a comma character ',' and then treated as the list of enzymes to search for. An example of a file of enzyme names is: ! my enzymes HincII, ppiII ! other enzymes hindiii HinfI PpiI Any string is accepted all
-sitelen This sets the minimum length of the restriction enzyme recognition site. Any enzymes with sites shorter than this will be ignored. Integer from 2 to 20 4
[-outfile]
(Parameter 2)
If you enter the name of a file here then this program will write the sequence details into that file. Output file <sequence>.remap
Optional qualifiers Allowed values Default
-mincuts This sets the minimum number of cuts for any restriction enzyme that will be considered. Any enzymes that cut fewer times than this will be ignored. Integer from 1 to 1000 1
-maxcuts This sets the maximum number of cuts for any restriction enzyme that will be considered. Any enzymes that cut more times than this will be ignored. Integer up to 2000000000 2000000000
-single If this is set then this forces the values of the mincuts and maxcuts qualifiers to both be 1. Any other value you may have set them to will be ignored. Boolean value Yes/No No
-[no]blunt This allows those enzymes which cut at the same position on the forward and reverse strands to be considered. Boolean value Yes/No Yes
-[no]sticky This allows those enzymes which cut at different positions on the forward and reverse strands, leaving an overhang, to be considered. Boolean value Yes/No Yes
-[no]ambiguity This allows those enzymes which have one or more 'N' ambiguity codes in their pattern to be considered Boolean value Yes/No Yes
-plasmid If this is set then this allows searches for restriction enzyme recognition site and cut postions that span the end of the sequence to be considered. Boolean value Yes/No No
-[no]commercial If this is set, then only those enzymes with a commercial supplier will be searched for. This qualifier is ignored if you have specified an explicit list of enzymes to search for, rather than searching through 'all' the enzymes in the REBASE database. It is assumed that, if you are asking for an explicit enzyme, then you probably know where to get it from and so all enzymes names that you have asked to be searched for, and which cut, will be reported whether or not they have a commercial supplier. Boolean value Yes/No Yes
-table Genetic code to use
0 (Standard)
1 (Standard (with alternative initiation codons))
2 (Vertebrate Mitochondrial)
3 (Yeast Mitochondrial)
4 (Mold, Protozoan, Coelenterate Mitochondrial and Mycoplasma/Spiroplasma)
5 (Invertebrate Mitochondrial)
6 (Ciliate Macronuclear and Dasycladacean)
9 (Echinoderm Mitochondrial)
10 (Euplotid Nuclear)
11 (Bacterial)
12 (Alternative Yeast Nuclear)
13 (Ascidian Mitochondrial)
14 (Flatworm Mitochondrial)
15 (Blepharisma Macronuclear)
16 (Chlorophycean Mitochondrial)
21 (Trematode Mitochondrial)
22 (Scenedesmus obliquus)
23 (Thraustochytrium Mitochondrial)
0
-[no]cutlist This produces lists in the output of the enzymes that cut, those that cut but are excluded because that cut fewer times than mincut or more times than maxcut and those enzymes that do not cut. Boolean value Yes/No Yes
-flatreformat This changes the output format to one where the recognition site is indicated by a row of '===' characters and the cut site is pointed to by a '>' character in the forward sense, or a '<' in the reverse sense strand. Boolean value Yes/No No
-[no]limit This limits the reporting of enzymes to just one enzyme from each group of isoschizomers. The enzyme chosen to represent an isoschizomer group is the prototype indicated in the data file 'embossre.equ', which is created by the program 'rebaseextract'. If you prefer different prototypes to be used, make a copy of embossre.equ in your home directory and edit it. If this value is set to be false then all of the input enzymes will be reported. You might like to set this to false if you are supplying an explicit set of enzymes rather than searching 'all' of them. Boolean value Yes/No Yes
Advanced qualifiers Allowed values Default
-[no]translation This displays the 6-frame translations of the sequence in the output. Boolean value Yes/No Yes
-[no]reverse This displays the cut sites and translation of the reverse sense. Boolean value Yes/No Yes
-orfminsize This sets the minimum size of Open Reading Frames (ORFs) to display in the translations. All other translation regions are masked by changing the amino acids to '-' characters. Integer 0 or more If this value is left as 0 then all of the translation is shown.
-uppercase Regions to put in uppercase. If this is left blank, then the sequence case is left alone. A set of regions is specified by a set of pairs of positions. The positions are integers. They are separated by any non-digit, non-alpha character. Examples of region specifications are: 24-45, 56-78 1:45, 67=99;765..888 1,5,8,10,23,45,57,99 Sequence range If this is left blank, then the sequence case is left alone.
-highlight Regions to colour if formatting for HTML. If this is left blank, then the sequence is left alone. A set of regions is specified by a set of pairs of positions. The positions are integers. They are followed by any valid HTML font colour. Examples of region specifications are: 24-45 blue 56-78 orange 1-100 green 120-156 red A file of ranges to colour (one range per line) can be specifed as '@filename'. Sequence range full sequence
-threeletter Display protein sequences in three-letter code Boolean value Yes/No No
-number Number the sequences Boolean value Yes/No No
-width Width of sequence to display Integer 1 or more 60
-length Line length of page (0 for indefinite) Integer 0 or more 0
-margin Margin around sequence for numbering Integer 0 or more 10
-[no]name Set this to be false if you do not wish to display the ID name of the sequence Boolean value Yes/No Yes
-[no]description Set this to be false if you do not wish to display the description of the sequence Boolean value Yes/No Yes
-offset Offset to start numbering the sequence from Any integer value 1
-html Use HTML formatting Boolean value Yes/No No

Input file format

Input files for usage example

'tembl:eclac' is a sequence entry in the example nucleic acid database 'tembl'

Database entry: tembl:eclac

ID   ECLAC      standard; DNA; PRO; 7477 BP.
XX
AC   J01636; J01637; K01483; K01793;
XX
SV   J01636.1
XX
DT   30-NOV-1990 (Rel. 26, Created)
DT   04-MAR-2000 (Rel. 63, Last updated, Version 7)
XX
DE   E.coli lactose operon with lacI, lacZ, lacY and lacA genes.
XX
KW   acetyltransferase; beta-D-galactosidase; galactosidase; lac operon;
KW   lac repressor protein; lacA gene; lacI gene; lactose permease; lacY gene;
KW   lacZ gene; mutagenesis; palindrome; promoter region;
KW   thiogalactoside acetyltransferase.
XX
OS   Escherichia coli
OC   Bacteria; Proteobacteria; gamma subdivision; Enterobacteriaceae;
OC   Escherichia.
XX
RN   [1]
RP   1243-1266
RX   MEDLINE; 74055539.
RA   Gilbert W., Maxam A.;
RT   "The nucleotide sequence of the lac operator";
RL   Proc. Natl. Acad. Sci. U.S.A. 70:3581-3584(1973).
XX
RN   [2]
RP   1246-1308
RX   MEDLINE; 74055540.
RA   Maizels N.M.;
RT   "The nucleotide sequence of the lactose messenger ribonucleic acid
RT   transcribed from the UV5 promoter mutant of Escherichia coli";
RL   Proc. Natl. Acad. Sci. U.S.A. 70:3585-3589(1973).
XX
RN   [3]
RX   MEDLINE; 74174501.
RA   Gilbert W., Maizels N., Maxam A.;
RT   "Sequences of controlling regions of the lactose operon";
RL   Cold Spring Harb. Symp. Quant. Biol. 38:845-855(1974).
XX
RN   [4]
RA   Gilbert W., Gralla J., Majors A.J., Maxam A.;
RT   "Lactose operator sequences and the action of lac repressor";
RL   (in) Sund H., Blauer G. (eds.);
RL   PROTEIN-LIGAND INTERACTIONS:193-207;
RL   Walter de Gruyter, New York (1975)
XX
RN   [5]
RP   1146-1282


  [Part of this file has been deleted for brevity]

     cgatttggct acatgacatc aaccatatca gcaaaagtga tacgggtatt atttttgccg      4560
     ctatttctct gttctcgcta ttattccaac cgctgtttgg tctgctttct gacaaactcg      4620
     ggctgcgcaa atacctgctg tggattatta ccggcatgtt agtgatgttt gcgccgttct      4680
     ttatttttat cttcgggcca ctgttacaat acaacatttt agtaggatcg attgttggtg      4740
     gtatttatct aggcttttgt tttaacgccg gtgcgccagc agtagaggca tttattgaga      4800
     aagtcagccg tcgcagtaat ttcgaatttg gtcgcgcgcg gatgtttggc tgtgttggct      4860
     gggcgctgtg tgcctcgatt gtcggcatca tgttcaccat caataatcag tttgttttct      4920
     ggctgggctc tggctgtgca ctcatcctcg ccgttttact ctttttcgcc aaaacggatg      4980
     cgccctcttc tgccacggtt gccaatgcgg taggtgccaa ccattcggca tttagcctta      5040
     agctggcact ggaactgttc agacagccaa aactgtggtt tttgtcactg tatgttattg      5100
     gcgtttcctg cacctacgat gtttttgacc aacagtttgc taatttcttt acttcgttct      5160
     ttgctaccgg tgaacagggt acgcgggtat ttggctacgt aacgacaatg ggcgaattac      5220
     ttaacgcctc gattatgttc tttgcgccac tgatcattaa tcgcatcggt gggaaaaacg      5280
     ccctgctgct ggctggcact attatgtctg tacgtattat tggctcatcg ttcgccacct      5340
     cagcgctgga agtggttatt ctgaaaacgc tgcatatgtt tgaagtaccg ttcctgctgg      5400
     tgggctgctt taaatatatt accagccagt ttgaagtgcg tttttcagcg acgatttatc      5460
     tggtctgttt ctgcttcttt aagcaactgg cgatgatttt tatgtctgta ctggcgggca      5520
     atatgtatga aagcatcggt ttccagggcg cttatctggt gctgggtctg gtggcgctgg      5580
     gcttcacctt aatttccgtg ttcacgctta gcggccccgg cccgctttcc ctgctgcgtc      5640
     gtcaggtgaa tgaagtcgct taagcaatca atgtcggatg cggcgcgacg cttatccgac      5700
     caacatatca taacggagtg atcgcattga acatgccaat gaccgaaaga ataagagcag      5760
     gcaagctatt taccgatatg tgcgaaggct taccggaaaa aagacttcgt gggaaaacgt      5820
     taatgtatga gtttaatcac tcgcatccat cagaagttga aaaaagagaa agcctgatta      5880
     aagaaatgtt tgccacggta ggggaaaacg cctgggtaga accgcctgtc tatttctctt      5940
     acggttccaa catccatata ggccgcaatt tttatgcaaa tttcaattta accattgtcg      6000
     atgactacac ggtaacaatc ggtgataacg tactgattgc acccaacgtt actctttccg      6060
     ttacgggaca ccctgtacac catgaattga gaaaaaacgg cgagatgtac tcttttccga      6120
     taacgattgg caataacgtc tggatcggaa gtcatgtggt tattaatcca ggcgtcacca      6180
     tcggggataa ttctgttatt ggcgcgggta gtatcgtcac aaaagacatt ccaccaaacg      6240
     tcgtggcggc tggcgttcct tgtcgggtta ttcgcgaaat aaacgaccgg gataagcact      6300
     attatttcaa agattataaa gttgaatcgt cagtttaaat tataaaaatt gcctgatacg      6360
     ctgcgcttat caggcctaca agttcagcga tctacattag ccgcatccgg catgaacaaa      6420
     gcgcaggaac aagcgtcgca tcatgcctct ttgacccaca gctgcggaaa acgtactggt      6480
     gcaaaacgca gggttatgat catcagccca acgacgcaca gcgcatgaaa tgcccagtcc      6540
     atcaggtaat tgccgctgat actacgcagc acgccagaaa accacggggc aagcccggcg      6600
     atgataaaac cgattccctg cataaacgcc accagcttgc cagcaatagc cggttgcaca      6660
     gagtgatcga gcgccagcag caaacagagc ggaaacgcgc cgcccagacc taacccacac      6720
     accatcgccc acaataccgg caattgcatc ggcagccaga taaagccgca gaaccccacc      6780
     agttgtaaca ccagcgccag cattaacagt ttgcgccgat cctgatggcg agccatagca      6840
     ggcatcagca aagctcctgc ggcttgccca agcgtcatca atgccagtaa ggaaccgctg      6900
     tactgcgcgc tggcaccaat ctcaatatag aaagcgggta accaggcaat caggctggcg      6960
     taaccgccgt taatcagacc gaagtaaaca cccagcgtcc acgcgcgggg agtgaatacc      7020
     acgcgaaccg gagtggttgt tgtcttgtgg gaagaggcga cctcgcgggc gctttgccac      7080
     caccaggcaa agagcgcaac aacggcaggc agcgccacca ggcgagtgtt tgataccagg      7140
     tttcgctatg ttgaactaac cagggcgtta tggcggcacc aagcccaccg ccgcccatca      7200
     gagccgcgga ccacagcccc atcaccagtg gcgtgcgctg ctgaaaccgc cgtttaatca      7260
     ccgaagcatc accgcctgaa tgatgccgat ccccacccca ccaagcagtg cgctgctaag      7320
     cagcagcgca ctttgcgggt aaagctcacg catcaatgca ccgacggcaa tcagcaacag      7380
     actgatggcg acactgcgac gttcgctgac atgctgatga agccagcttc cggccagcgc      7440
     cagcccgccc atggtaacca ccggcagagc ggtcgac                               7477
//

You can specifiy a file of ranges to display in uppercase by giving the '-uppercase' qualifier the value '@' followed by the name of the file containing the ranges. (eg: '-upper @myfile').

The format of the range file is:

An example range file is:


# this is my set of ranges
12   23
 4   5       this is like 12-23, but smaller
67   10348   interesting region

You can specifiy a file of ranges to highlight in a different colour when outputting in HTML format (using the '-html' qualifier) by giving the '-highlight' qualifier the value '@' followed by the name of the file containing the ranges. (eg: '-highlight @myfile').

The format of this file is very similar to the format of the above uppercase range file, except that the text after the start and end positions is used as the HTML colour name. This colour name is used 'as is' when specifying the colour in HTML in a '<FONT COLOR=xxx>' construct, (where 'xxx' is the name of the colour).

The standard names of HTML font colours are given in:
http://http://www.w3.org/TR/REC-html40/types.html and http://www.ausmall.com.au/freegraf/ncolour2.htm and http://mindprod.com/htmlcolours.html (amongst other places).

An example highlight range file is:


# this is my set of ranges
12   23		red
 4   5		darkturquoise
67   10348	#FFE4E1

Output file format

Output files for usage example

File: eclac.remap

ECLAC
E.coli lactose operon with lacI, lacZ, lacY and lacA genes.

                                                        BssKI
                 TaqI                 AciI              Ksp632I
                 \                    \                 \
          GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGT
                   10        20        30        40        50        60        
          ----:----|----:----|----:----|----:----|----:----|----:----|
          CTGTGGTAGCTTACCGCGTTTTGGAAAGCGCCATACCGTACTATCGCGGGCCTTCTCTCA
                   /                    /                  / /
                   TaqI                 AciI               | BssKI 
                                                           Ksp632I


# Enzymes that cut  Frequency	Isoschizomers
      AciI	    1	
     BssKI	    1	
   Ksp632I	    1	Bsu6I
      TaqI	    1	



# Enzymes < MINCUTS Frequency	Isoschizomers



# Enzymes > MAXCUTS Frequency	Isoschizomers



# Enzymes that do not cut




# No. of cutting REs not matching SITELEN, BLUNT, STICKY, COMMERCIAL criteria

0

Output files for usage example 2

File: eclac.remap

ECLAC
E.coli lactose operon with lacI, lacZ, lacY and lacA genes.

                                                      Hin6I
                 TaqI                                 | HhaI
                 |  BsiYI                             | BssKI
                 |  |   Hin6I                         | Ksp632I
                 |  |   | HhaI        AciI            | | HpaII 
                 \  \   \ \           \               \ \ \
          GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGT
                   10        20        30        40        50        60        
          ----:----|----:----|----:----|----:----|----:----|----:----|
          CTGTGGTAGCTTACCGCGTTTTGGAAAGCGCCATACCGTACTATCGCGGGCCTTCTCTCA
                 / /    / /             /             / /  ///
                 | TaqI | Hin6I         AciI          | |  ||BssKI 
                 BsiYI  HhaI                          | |  |HpaII  
                                                      | |  Ksp632I
                                                      | Hin6I
                                                      HhaI


# Enzymes that cut  Frequency	Isoschizomers
      AciI	    1	
     BsiYI	    1	Bsc4I
     BssKI	    1	
      HhaI	    2	
     Hin6I	    2	HinP1I,HspAI
     HpaII	    1	BsiSI
   Ksp632I	    1	Bsu6I
      TaqI	    1	



# Enzymes < MINCUTS Frequency	Isoschizomers



# Enzymes > MAXCUTS Frequency	Isoschizomers



# Enzymes that do not cut

AclI      BamHI     BceAI     BsrI      ClaI      EcoRI     EcoRII    HaeIII    
Hin4I     HindII    HindIII   KpnI      MaeII     NotI      


# No. of cutting REs not matching SITELEN, BLUNT, STICKY, COMMERCIAL criteria

0

Output files for usage example 3

File: eclac.remap

ECLAC
E.coli lactose operon with lacI, lacZ, lacY and lacA genes.

                                                      HspAI
                 TaqI                                 Hin6I 
                 |  Bsc4I                             HinP1I
                 |  |   HspAI                         | HhaI 
                 |  |   Hin6I                         | BssKI
                 |  |   HinP1I                        | Bsu6I 
                 |  |   | HhaI        AciI            | | BsiSI
                 \  \   \ \           \               \ \ \
          GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGT
                   10        20        30        40        50        60        
          ----:----|----:----|----:----|----:----|----:----|----:----|
          CTGTGGTAGCTTACCGCGTTTTGGAAAGCGCCATACCGTACTATCGCGGGCCTTCTCTCA
                 / /    / /             /             / /  ///
                 | TaqI | HinP1I        AciI          | |  ||BssKI
                 Bsc4I  | Hin6I                       | |  |BsiSI
                        | HspAI                       | |  Bsu6I
                        HhaI                          | HinP1I
                                                      | HspAI 
                                                      | Hin6I
                                                      HhaI


# Enzymes that cut  Frequency
      AciI	    1	
     Bsc4I	    1	
     BsiSI	    1	
     BssKI	    1	
     Bsu6I	    1	
      HhaI	    2	
     Hin6I	    2	
    HinP1I	    2	
     HspAI	    2	
      TaqI	    1	



# Enzymes < MINCUTS Frequency



# Enzymes > MAXCUTS Frequency



# Enzymes that do not cut

AclI      BamHI     BceAI     Bse1I     BshI      ClaI      EcoRI     EcoRII    
Hin4I     HindII    HindIII   HpyCH4IV  KpnI      NotI      


# No. of cutting REs not matching SITELEN, BLUNT, STICKY, COMMERCIAL criteria

0

Output files for usage example 4

File: eclac.remap

ECLAC
E.coli lactose operon with lacI, lacZ, lacY and lacA genes.

                                                                  Ksp632I
                                                        >.........====
                                                          HpaII
                                                          >===
                        HhaI                             BssKI
                        ==>=                            >=====
                 TaqI   Hin6I                         HhaI
                 >===   >===                          ==>=
              BsiYI                      AciI         Hin6I
              ======>====             >..====         >===
          GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGT
                   10        20        30        40        50        60        
          ----:----|----:----|----:----|----:----|----:----|----:----|
          CTGTGGTAGCTTACCGCGTTTTGGAAAGCGCCATACCGTACTATCGCGGGCCTTCTCTCA
              ====<======                <===         ===<
              BsiYI                      AciI         Hin6I
                 ===<   ===<                          =<==  <.....====
                 TaqI   Hin6I                         HhaI        Ksp632I
                        =<==                             =====<
                        HhaI                             BssKI
                                                          ===<
                                                          HpaII


# Enzymes that cut  Frequency	Isoschizomers
      AciI	    1	
     BsiYI	    1	Bsc4I
     BssKI	    1	
      HhaI	    2	
     Hin6I	    2	HinP1I,HspAI
     HpaII	    1	BsiSI
   Ksp632I	    1	Bsu6I
      TaqI	    1	



# Enzymes < MINCUTS Frequency	Isoschizomers



# Enzymes > MAXCUTS Frequency	Isoschizomers



# Enzymes that do not cut

AclI      BamHI     BceAI     BsrI      ClaI      EcoRI     EcoRII    HaeIII    
Hin4I     HindII    HindIII   KpnI      MaeII     NotI      


# No. of cutting REs not matching SITELEN, BLUNT, STICKY, COMMERCIAL criteria

0

The name of the sequence is displayed, followed by the description of the sequence.

The formatted display of cut sites on the sequence follows, with the six-frame translation below it. The cut sites are indicated by a slash character '\' that points to the poition between the nucleotides where the cuts occur. Cuts by many enzymes at the same position are indicated by stacking the enzyme names on top of each other.

At the end the section header 'Enzymes that cut' is displayed followed by a list of the enzymes that cut the specified sequence and the number of times that they cut. For each enzyme that cuts, a list of isoschizomers of that enzyme (sharing the same recognition site pattern and cut sites) is given.

This is followed by lists of the enzymes that do cut, but which cut less often than the '-mincut' qualifier or more often than the '-maxcut' qualifier.

Any of the isoschizomers that are excluded from cutting, (either through restrictions such as the permitted number of cuts, blunt cutters only, single cutters only etc. or because their name has not been given in the input list of enzymes), will not be listed.

Then a list is displayed of the enzymes whose names were input and which match the other criteria ('-sitelen', '-blunt', '-sticky' or '-commercial') but which do not cut.

Finally the number of enzymes that were rejected from consideration because they do not match the '-sitelen', '-blunt', '-sticky' or '-commercial' criteria is displayed.

The '-flatreformat' qualifier changes the display to emphasise the recognition site of the restriction enzyme, which is indicated by a row of '=' characters. The cut site if pointed to by a '>' or '<' character and if the cut site is not within or imemdiately adjacent to the recognition site, they are linked by a row or '.' characters.

The name of the enzyme is displayed above (or below when the reverse sense site if displayed) the recognition site. The name of the enzyme is also displayed above the cut site if this occurs on a different display line to the recognition site (i.e. if it wraps onto the next line of sequence).

Data files

This uses the EMBOSS REBASE data files in 'data/REBASE/*' under the EMBOSS installation directory.

These files must first be set up using the program 'rebaseextract'. Running 'rebaseextract' may be the job of your system manager.

EMBOSS data files are distributed with the application and stored in the standard EMBOSS data directory, which is defined by the EMBOSS environment variable EMBOSS_DATA.

To see the available EMBOSS data files, run:

% embossdata -showall

To fetch one of the data files (for example 'Exxx.dat') into your current directory for you to inspect or modify, run:


% embossdata -fetch -file Exxx.dat

Users can provide their own data files in their own directories. Project specific files can be put in the current directory, or for tidier directory listings in a subdirectory called ".embossdata". Files for all EMBOSS runs can be put in the user's home directory, or again in a subdirectory called ".embossdata".

The directories are searched in the following order:

The data files are stored in the REBASE directory of the standard EMBOSS data directory. The names are:

The column information is described at the top of the data files

The reported enzyme from any one group of isoschizomers (the prototype) is specified in the REBASE database and the information is held in the data file 'embossre.equ'. You may edit this file to set your own preferred prototype,if you wish.

The format of the file "embossre.equ" is
Enzyme-name Prototype-name

i.e. two columns of enzyme names separated by a space. The first name of the pair of enzymes is the name that is not preferred and the second is the preferred, prototype name.

Notes

None.

References

None.

Warnings

None.

Diagnostic Error Messages

None.

Exit status

It always exits with status 0.

Known bugs

None.

See also

Program nameDescription
abiviewReads ABI file and display the trace
backtranseqBack translate a protein sequence
cirdnaDraws circular maps of DNA constructs
coderetExtract CDS, mRNA and translations from feature tables
lindnaDraws linear maps of DNA constructs
pepnetDisplays proteins as a helical net
pepwheelShows protein sequences as helices
plotorfPlot potential open reading frames
prettyplotDisplays aligned sequences, with colouring and boxing
prettyseqOutput sequence with translated ranges
recoderRemove restriction sites but maintain the same translation
redataSearch REBASE for enzyme name, references, suppliers etc
restoverFinds restriction enzymes that produce a specific overhang
restrictFinds restriction enzyme cleavage sites
seealsoFinds programs sharing group names
showalignDisplays a multiple sequence alignment
showdbDisplays information on the currently available databases
showfeatShow features of a sequence
showorfPretty output of DNA translations
showseqDisplay a sequence with features, translation etc
silentSilent mutation restriction enzyme scan
sixpackDisplay a DNA sequence with 6-frame translation and ORFs
textsearchSearch sequence documentation text. SRS and Entrez are faster!
transeqTranslate nucleic acid sequences

Author(s)

Gary Williams (gwilliam © hgmp.mrc.ac.uk)
HGMP-RC, Genome Campus, Hinxton, Cambridge CB10 1SB, UK

History

Written Spring 2000

Changed 7 Dec 2000 - GWW - to declare isoschizomers that cut

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

Comments