showorf

 

Function

Pretty output of DNA translations

Description

Showorf displays a nucleic acid sequence with its protein translation in a style suitable for publication. The translation can be done in any frame or combination of frames.

It uses codon frequency files to do the translation. You can specify the codon frequency file that you use with the '-cfile' option. The default table is 'Ehum.cut'.

Usage

Here is a sample session with showorf


% showorf 
Pretty output of DNA translations
Input sequence: tembl:paamir
Select Frames To Translate
         0 : None
         1 : F1
         2 : F2
         3 : F3
         4 : R1
         5 : R2
         6 : R3
Select one or more values [1,2,3,4,5,6]: 
Output file [paamir.showorf]: 

Go to the input files for this example
Go to the output files for this example

Command line arguments

   Mandatory qualifiers:
  [-sequence]          sequence   Sequence USA
   -frames             menu       Select one or more values
  [-outfile]           outfile    Output file name

   Optional qualifiers:
   -[no]ruler          boolean    Add a ruler
   -[no]plabel         boolean    Number translations
   -[no]nlabel         boolean    Number DNA sequence

   Advanced qualifiers:
   -cfile              codon      Codon usage file
   -width              integer    Width of screen

   Associated qualifiers:
  "-sequence" related qualifiers
   -sbegin1             integer    First base used
   -send1               integer    Last base used, def=seq length
   -sreverse1           boolean    Reverse (if DNA)
   -sask1               boolean    Ask for begin/end/reverse
   -snucleotide1        boolean    Sequence is nucleotide
   -sprotein1           boolean    Sequence is protein
   -slower1             boolean    Make lower case
   -supper1             boolean    Make upper case
   -sformat1            string     Input sequence format
   -sopenfile1          string     Input filename
   -sdbname1            string     Database name
   -sid1                string     Entryname
   -ufo1                string     UFO features
   -fformat1            string     Features format
   -fopenfile1          string     Features file name
  "-outfile" related qualifiers
   -odirectory2         string     Output directory

   General qualifiers:
   -auto                boolean    Turn off prompts
   -stdout              boolean    Write standard output
   -filter              boolean    Read standard input, write standard output
   -options             boolean    Prompt for required and optional values
   -debug               boolean    Write debug output to program.dbg
   -acdlog              boolean    Write ACD processing log to program.acdlog
   -acdpretty           boolean    Rewrite ACD file as program.acdpretty
   -acdtable            boolean    Write HTML table of options
   -verbose             boolean    Report some/full command line options
   -help                boolean    Report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning             boolean    Report warnings
   -error               boolean    Report errors
   -fatal               boolean    Report fatal errors
   -die                 boolean    Report deaths


Mandatory qualifiers Allowed values Default
[-sequence]
(Parameter 1)
Sequence USA Readable sequence Required
-frames Select one or more values
0 (None)
1 (F1)
2 (F2)
3 (F3)
4 (R1)
5 (R2)
6 (R3)
1,2,3,4,5,6
[-outfile]
(Parameter 2)
Output file name Output file <sequence>.showorf
Optional qualifiers Allowed values Default
-[no]ruler Add a ruler Boolean value Yes/No Yes
-[no]plabel Number translations Boolean value Yes/No Yes
-[no]nlabel Number DNA sequence Boolean value Yes/No Yes
Advanced qualifiers Allowed values Default
-cfile Codon usage file Codon usage file in EMBOSS data path Ehum.cut
-width Width of screen Integer 10 or more 50

Input file format

showorf reads a normal nucleic acid sequence USA.

Input files for usage example

'tembl:paamir' is a sequence entry in the example nucleic acid database 'tembl'

Database entry: tembl:paamir

ID   PAAMIR     standard; DNA; PRO; 2167 BP.
XX
AC   X13776; M43175;
XX
SV   X13776.1
XX
DT   19-APR-1989 (Rel. 19, Created)
DT   17-FEB-1997 (Rel. 50, Last updated, Version 22)
XX
DE   Pseudomonas aeruginosa amiC and amiR gene for aliphatic amidase regulation
XX
KW   aliphatic amidase regulator; amiC gene; amiR gene.
XX
OS   Pseudomonas aeruginosa
OC   Bacteria; Proteobacteria; gamma subdivision; Pseudomonadaceae; Pseudomonas.
XX
RN   [1]
RP   1167-2167
RA   Rice P.M.;
RT   ;
RL   Submitted (16-DEC-1988) to the EMBL/GenBank/DDBJ databases.
RL   Rice P.M., EMBL, Postfach 10-2209, Meyerhofstrasse 1, 6900 Heidelberg, FRG.
XX
RN   [2]
RP   1167-2167
RX   MEDLINE; 89211409.
RA   Lowe N., Rice P.M., Drew R.E.;
RT   "Nucleotide sequence of the aliphatic amidase regulator gene of Pseudomonas
RT   aeruginosa";
RL   FEBS Lett. 246:39-43(1989).
XX
RN   [3]
RP   1-1292
RX   MEDLINE; 91317707.
RA   Wilson S., Drew R.;
RT   "Cloning and DNA seqence of amiC, a new gene regulating expression of the
RT   Pseudomonas aeruginosa aliphatic amidase, and purification of the amiC
RT   product.";
RL   J. Bacteriol. 173:4914-4921(1991).
XX
RN   [4]
RP   1-2167
RA   Rice P.M.;
RT   ;
RL   Submitted (04-SEP-1991) to the EMBL/GenBank/DDBJ databases.
RL   Rice P.M., EMBL, Postfach 10-2209, Meyerhofstrasse 1, 6900 Heidelberg, FRG.
XX
DR   SWISS-PROT; P10932; AMIR_PSEAE.
DR   SWISS-PROT; P27017; AMIC_PSEAE.
DR   SWISS-PROT; Q51417; AMIS_PSEAE.


  [Part of this file has been deleted for brevity]

FT                   phenotype"
FT                   /replace=""
FT                   /gene="amiC"
FT   misc_feature    1
FT                   /note="last base of an XhoI site"
FT   misc_feature    648..653
FT                   /note="end of 658bp XhoI fragment, deletion in  pSW3 causes
FT                   constitutive expression of amiE"
FT   conflict        1281
FT                   /replace="g"
FT                   /citation=[3]
XX
SQ   Sequence 2167 BP; 363 A; 712 C; 730 G; 362 T; 0 other;
     ggtaccgctg gccgagcatc tgctcgatca ccaccagccg ggcgacggga actgcacgat        60
     ctacctggcg agcctggagc acgagcgggt tcgcttcgta cggcgctgag cgacagtcac       120
     aggagaggaa acggatggga tcgcaccagg agcggccgct gatcggcctg ctgttctccg       180
     aaaccggcgt caccgccgat atcgagcgct cgcacgcgta tggcgcattg ctcgcggtcg       240
     agcaactgaa ccgcgagggc ggcgtcggcg gtcgcccgat cgaaacgctg tcccaggacc       300
     ccggcggcga cccggaccgc tatcggctgt gcgccgagga cttcattcgc aaccgggggg       360
     tacggttcct cgtgggctgc tacatgtcgc acacgcgcaa ggcggtgatg ccggtggtcg       420
     agcgcgccga cgcgctgctc tgctacccga ccccctacga gggcttcgag tattcgccga       480
     acatcgtcta cggcggtccg gcgccgaacc agaacagtgc gccgctggcg gcgtacctga       540
     ttcgccacta cggcgagcgg gtggtgttca tcggctcgga ctacatctat ccgcgggaaa       600
     gcaaccatgt gatgcgccac ctgtatcgcc agcacggcgg cacggtgctc gaggaaatct       660
     acattccgct gtatccctcc gacgacgact tgcagcgcgc cgtcgagcgc atctaccagg       720
     cgcgcgccga cgtggtcttc tccaccgtgg tgggcaccgg caccgccgag ctgtatcgcg       780
     ccatcgcccg tcgctacggc gacggcaggc ggccgccgat cgccagcctg accaccagcg       840
     aggcggaggt ggcgaagatg gagagtgacg tggcagaggg gcaggtggtg gtcgcgcctt       900
     acttctccag catcgatacg cccgccagcc gggccttcgt ccaggcctgc catggtttct       960
     tcccggagaa cgcgaccatc accgcctggg ccgaggcggc ctactggcag accttgttgc      1020
     tcggccgcgc cgcgcaggcc gcaggcaact ggcgggtgga agacgtgcag cggcacctgt      1080
     acgacatcga catcgacgcg ccacaggggc cggtccgggt ggagcgccag aacaaccaca      1140
     gccgcctgtc ttcgcgcatc gcggaaatcg atgcgcgcgg cgtgttccag gtccgctggc      1200
     agtcgcccga accgattcgc cccgaccctt atgtcgtcgt gcataacctc gacgactggt      1260
     ccgccagcat gggcggggga ccgctcccat gagcgccaac tcgctgctcg gcagcctgcg      1320
     cgagttgcag gtgctggtcc tcaacccgcc gggggaggtc agcgacgccc tggtcttgca      1380
     gctgatccgc atcggttgtt cggtgcgcca gtgctggccg ccgccggaag ccttcgacgt      1440
     gccggtggac gtggtcttca ccagcatttt ccagaatggc caccacgacg agatcgctgc      1500
     gctgctcgcc gccgggactc cgcgcactac cctggtggcg ctggtggagt acgaaagccc      1560
     cgcggtgctc tcgcagatca tcgagctgga gtgccacggc gtgatcaccc agccgctcga      1620
     tgcccaccgg gtgctgcctg tgctggtatc ggcgcggcgc atcagcgagg aaatggcgaa      1680
     gctgaagcag aagaccgagc agctccagga ccgcatcgcc ggccaggccc ggatcaacca      1740
     ggccaaggtg ttgctgatgc agcgccatgg ctgggacgag cgcgaggcgc accagcacct      1800
     gtcgcgggaa gcgatgaagc ggcgcgagcc gatcctgaag atcgctcagg agttgctggg      1860
     aaacgagccg tccgcctgag cgatccgggc cgaccagaac aataacaaga ggggtatcgt      1920
     catcatgctg ggactggttc tgctgtacgt tggcgcggtg ctgtttctca atgccgtctg      1980
     gttgctgggc aagatcagcg gtcgggaggt ggcggtgatc aacttcctgg tcggcgtgct      2040
     gagcgcctgc gtcgcgttct acctgatctt ttccgcagca gccgggcagg gctcgctgaa      2100
     ggccggagcg ctgaccctgc tattcgcttt tacctatctg tgggtggccg ccaaccagtt      2160
     cctcgag                                                                2167
//

Output file format

As a sequence with high GC content (from Pseudmonas aeruginosa) PAAMIR has several overlapping open reading frames.

The true ORFs are 1..109 (amiB partial) 135..1292 (amiC) 1289..1879 (amiR) 1925..end (amiS partial)

Output files for usage example

File: paamir.showorf

SHOWORF of PAAMIR from 1 to 2167

           ---------|---------|---------|---------|---------|
         1 ggtaccgctggccgagcatctgctcgatcaccaccagccgggcgacggga 50
F1       1 G  T  A  G  R  A  S  A  R  S  P  P  A  G  R  R  E  17
F2       1  V  P  L  A  E  H  L  L  D  H  H  Q  P  G  D  G  N 17
F3       1   Y  R  W  P  S  I  C  S  I  T  T  S  R  A  T  G   16
R1       9   T  G  S  A  S  C  R  S  S  *  W  W  G  P  S  P   5
R2     106    Y  R  Q  G  L  M  Q  E  I  V  V  L  R  A  V  P  91
R3      38     V  A  P  R  A  D  A  R  D  G  G  A  P  R  R  S 23

           ---------|---------|---------|---------|---------|
        51 actgcacgatctacctggcgagcctggagcacgagcgggttcgcttcgta 100
F1      18  L  H  D  L  P  G  E  P  G  A  R  A  G  S  L  R  T 34
F2      18   C  T  I  Y  L  A  S  L  E  H  E  R  V  R  F  V   33
F3      17 T  A  R  S  T  W  R  A  W  S  T  S  G  F  A  S  Y  33
R1       4 F  Q  V  I  *  R  A  L  R  S  C  S  R  T  R  K  T  31
R2      90  V  A  R  D  V  Q  R  A  Q  L  V  L  P  N  A  E  Y 74
R3      22   S  C  S  R  G  P  S  G  P  A  R  A  P  E  S  R   7

           ---------|---------|---------|---------|---------|
       101 cggcgctgagcgacagtcacaggagaggaaacggatgggatcgcaccagg 150
F1      35   A  L  S  D  S  H  R  R  G  N  G  W  D  R  T  R   50
F2      34 R  R  *  A  T  V  T  G  E  E  T  D  G  I  A  P  G  14
F3      34  G  A  E  R  Q  S  Q  E  R  K  R  M  G  S  H  Q  E 50
R1      30  R  R  Q  A  V  T  V  P  S  S  V  S  P  I  A  G  P 14
R2      73   P  A  S  R  C  D  C  S  L  F  R  I  P  D  C  W   58
R3       6 V  A  S  L  S  L  *  L  L  P  F  P  H  S  R  V  L  398

           ---------|---------|---------|---------|---------|
       151 agcggccgctgatcggcctgctgttctccgaaaccggcgtcaccgccgat 200
F1      51 S  G  R  *  S  A  C  C  S  P  K  P  A  S  P  P  I  13
F2      15  A  A  A  D  R  P  A  V  L  R  N  R  R  H  R  R  Y 31
F3      51   R  P  L  I  G  L  L  F  S  E  T  G  V  T  A  D   66
R1      13   A  A  A  S  R  G  A  T  R  R  F  R  R  *  R  R   49
R2      57 S  R  G  S  I  P  R  S  N  E  S  V  P  T  V  A  S  41
R3     397  L  P  R  Q  D  A  Q  Q  E  G  F  G  A  D  G  G  I 381

           ---------|---------|---------|---------|---------|
       201 atcgagcgctcgcacgcgtatggcgcattgctcgcggtcgagcaactgaa 250
F1      14  S  S  A  R  T  R  M  A  H  C  S  R  S  S  N  *  T 1
F2      32   R  A  L  A  R  V  W  R  I  A  R  G  R  A  T  E   47
F3      67 I  E  R  S  H  A  Y  G  A  L  L  A  V  E  Q  L  N  83
R1      48 Y  R  A  S  A  R  T  H  R  M  A  R  P  R  A  V  S  32
R2      40  I  S  R  E  C  A  Y  P  A  N  S  A  T  S  C  S  F 24
R3     380   D  L  A  R  V  R  I  A  C  Q  E  R  D  L  L  Q   365

           ---------|---------|---------|---------|---------|
       251 ccgcgagggcggcgtcggcggtcgcccgatcgaaacgctgtcccaggacc 300
F1       2   A  R  A  A  S  A  V  A  R  S  K  R  C  P  R  T   17


  [Part of this file has been deleted for brevity]

F2       8 N  N  K  R  G  I  V  I  M  L  G  L  V  L  L  Y  V  24
F3      22  I  T  R  G  V  S  S  S  C  W  D  W  F  C  C  T  L 38
R1      53  L  L  L  L  P  I  T  M  M  S  P  S  T  R  S  Y  T 37
R2      73   I  V  L  P  T  D  D  D  H  Q  S  Q  N  Q  Q  V   58
R3       7 C  Y  C  S  P  Y  R  *  *  A  P  V  P  E  A  T  R  7

           ---------|---------|---------|---------|---------|
      1951 tggcgcggtgctgtttctcaatgccgtctggttgctgggcaagatcagcg 2000
F1      16 W  R  G  A  V  S  Q  C  R  L  V  A  G  Q  D  Q  R  32
F2      25  G  A  V  L  F  L  N  A  V  W  L  L  G  K  I  S  G 41
F3      39   A  R  C  C  F  S  M  P  S  G  C  W  A  R  S  A   54
R1      36   P  A  T  S  N  R  L  A  T  Q  N  S  P  L  I  L   21
R2      57 N  A  R  H  Q  K  E  I  G  D  P  Q  Q  A  L  D  A  41
R3       6  Q  R  P  A  T  E  *  H  R  R  T  A  P  C  S  *  R 7

           ---------|---------|---------|---------|---------|
      2001 gtcgggaggtggcggtgatcaacttcctggtcggcgtgctgagcgcctgc 2050
F1      33  S  G  G  G  G  D  Q  L  P  G  R  R  A  E  R  L  R 49
F2      42   R  E  V  A  V  I  N  F  L  V  G  V  L  S  A  C   57
F3      55 V  G  R  W  R  *  S  T  S  W  S  A  C  *  A  P  A  3
R1      20 P  R  S  T  A  T  I  L  K  R  T  P  T  S  L  A  Q  4
R2      40  T  P  L  H  R  H  D  V  E  Q  D  A  H  Q  A  G  A 24
R3       6   D  P  P  P  P  S  *  S  G  P  R  R  A  S  R  R   28

           ---------|---------|---------|---------|---------|
      2051 gtcgcgttctacctgatcttttccgcagcagccgggcagggctcgctgaa 2100
F1      50   R  V  L  P  D  L  F  R  S  S  R  A  G  L  A  E   65
F2      58 V  A  F  Y  L  I  F  S  A  A  A  G  Q  G  S  L  K  74
F3       4  S  R  S  T  *  S  F  P  Q  Q  P  G  R  A  R  *  R 1
R1       3  T  A  N  *  R  I  K  E  A  A  A  P  C  P  E  S  F 12
R2      23   D  R  E  V  Q  D  K  G  C  C  G  P  L  A  R  Q   8
R3      27 R  R  T  R  G  S  R  K  R  L  L  R  A  P  S  A  S  11

           ---------|---------|---------|---------|---------|
      2101 ggccggagcgctgaccctgctattcgcttttacctatctgtgggtggccg 2150
F1      66 G  R  S  A  D  P  A  I  R  F  Y  L  S  V  G  G  R  82
F2      75  A  G  A  L  T  L  L  F  A  F  T  Y  L  W  V  A  A 91
F3       2   P  E  R  *  P  C  Y  S  L  L  P  I  C  G  W  P   12
R1      11   A  P  A  S  V  R  S  N  A  K  V  *  R  H  T  A   7
R2       7 L  G  S  R  Q  G  Q  *  E  S  K  G  I  Q  P  H  G  7
R3      10  P  R  L  A  S  G  A  I  R  K  *  R  D  T  P  P  R 6

           ---------|-------
      2151 ccaaccagttcctcgag 2167
F1      83  Q  P  V  P  R    87
F2      92   N  Q  F  L  E   96
F3      13 P  T  S  S  S     17
R1       6 A  L  W  N  R  S  1
R2       6  G  V  L  E  E  L 1
R3       5   W  G  T  G  R   1

Data files

Showorf uses the codon frequency files to translate the sequence.

The codon usage table is read by default from "Ehum.cut" in the 'data/CODONS' directory of the EMBOSS distribution. If the name of a codon usage file is specified on the command line with the '-cfile' option, then this file will first be searched for in the current directory and then in the 'data/CODONS' directory of the EMBOSS distribution.

To see the available EMBOSS codon usage files, run:


% embossdata -showall

To fetch one of the codon usage tables (for example 'Emus.cut') into your current directory for you to inspect or modify, run:


% embossdata -fetch -file Emus.cut

Notes

None.

References

None.

Warnings

None.

Diagnostic Error Messages

None.

Exit status

It exits with a status of 0. It always exits with status 0.

Known bugs

None.

See also

Program nameDescription
backtranseqBack translate a protein sequence
coderetExtract CDS, mRNA and translations from feature tables
getorfFinds and extracts open reading frames (ORFs)
marscanFinds MAR/SAR sites in nucleic sequences
plotorfPlot potential open reading frames
prettyseqOutput sequence with translated ranges
remapDisplay a sequence with restriction cut sites, translation etc
showseqDisplay a sequence with features, translation etc
sixpackDisplay a DNA sequence with 6-frame translation and ORFs
sycoSynonymous codon usage Gribskov statistic plot
tcodeFickett TESTCODE statistic to identify protein-coding DNA
transeqTranslate nucleic acid sequences
wobbleWobble base plot

Author(s)

Alan Bleasby (ableasby © hgmp.mrc.ac.uk)
HGMP-RC, Genome Campus, Hinxton, Cambridge CB10 1SB, UK

History

1999 - written.

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

Comments